Stem-loop sequence chi-mir-301a

AccessionMI0030729 (change log)
DescriptionCapra hircus miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention chi-mir-301a
(1 sentences)

Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   -     aa  c     a    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 10147765-10147849 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-301a
chi-mir-301achr19: 10147765-10147849 [-]
chi-mir-454chr19: 10138115-10138228 [-]
Database links

Mature sequence chi-miR-301a-5p

Accession MIMAT0036118
Sequence

14 - 

gcucugacuuuauugcacuac

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-301a-3p

Accession MIMAT0036119
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).