Stem-loop sequence chi-mir-29c

AccessionMI0030728 (change log)
DescriptionCapra hircus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Literature search

8 open access papers mention chi-mir-29c
(17 sentences)

Stem-loop
   gagcaucaccggaccca         -  ggc           ucc       ---     u 
5'                  ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
                    ||||||||| ||   |||||||||||   |||||||   ||||| u
3'                  gggggaugu gu   auugguuaaag   accacga   guuuu g
   ------gacgacgaaag         a  ---           uuu       ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 77240814-77240927 [+]
intergenic
chr16: 77335341-77335454 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-29c
chi-mir-29bchr16: 77238818-77238901 [+]
chi-mir-29bchr16: 77240318-77240401 [+]
chi-mir-29cchr16: 77240814-77240927 [+]
chi-mir-29cchr16: 77335341-77335454 [+]
Database links

Mature sequence chi-miR-29c-5p

Accession MIMAT0036116
Sequence

32 - 

ugaccgauuucuccugguguuca

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-29c-3p

Accession MIMAT0036117
Sequence

70 - 

uagcaccauuugaaauugguu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).