Stem-loop sequence chi-mir-29b

AccessionMI0030727 (change log)
DescriptionCapra hircus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Literature search

6 open access papers mention chi-mir-29b
(17 sentences)

Stem-loop
   ---         -          c      g  u    uuuucc 
5'    cuucuggaa gcugguuuca auggug cu agau      a
      ||||||||| |||||||||| |||||| || ||||       
3'    gaggauuuu ugacuaaagu uaccac ga ucua      u
   aau         g          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 77238818-77238901 [+]
intergenic
chr16: 77240318-77240401 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-29b
chi-mir-29bchr16: 77238818-77238901 [+]
chi-mir-29bchr16: 77240318-77240401 [+]
chi-mir-29cchr16: 77240814-77240927 [+]
chi-mir-29cchr16: 77335341-77335454 [+]
Database links

Mature sequence chi-miR-29b-5p

Accession MIMAT0036114
Sequence

11 - 

cugguuucacaugguggcuuaga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-29b-3p

Accession MIMAT0036115
Sequence

52 - 

uagcaccauuugaaaucagu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).