Stem-loop sequence chi-mir-296

AccessionMI0030725 (change log)
DescriptionCapra hircus miR-296 stem-loop
Gene family MIPF0000159; mir-296
Literature search

1 open access papers mention chi-mir-296
(1 sentences)

Stem-loop
   a         c        c  -         g   u    
5'  ggacccuuc ggagggcc cc cccaauccu uug gcu 
    ||||||||| |||||||| || ||||||||| ||| || u
3'  ucugggaag ccuuucgg gg ggguuggga gac ugg 
   g         u        a  c         -   u    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr13: 58649190-58649268 [+]
intergenic
Database links

Mature sequence chi-miR-296-3p

Accession MIMAT0036111
Sequence

48 - 

aggguugggcggaggcuuuccu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).