Stem-loop sequence chi-mir-27b

AccessionMI0030723 (change log)
DescriptionCapra hircus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

10 open access papers mention chi-mir-27b
(83 sentences)

Stem-loop
   gcgacg    -    gacg                  auug        ugac     
5'       accu cucu    aggugcagagcuuagcug    gugaacag    uggu 
         |||| ||||    ||||||||||||||||||    ||||||||    ||| u
3'       ugga gaga    uccacgucuugaaucggu    cacuuguu    gccu 
   ----ag    a    --ag                  --ga        --uc     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 82818815-82818918 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-27b
chi-mir-23bchr8: 82818597-82818683 [+]
chi-mir-27bchr8: 82818815-82818918 [+]
chi-mir-24chr8: 82819368-82819447 [+]
Database links

Mature sequence chi-miR-27b-5p

Accession MIMAT0036107
Sequence

25 - 

agagcuuagcugauuggugaac

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-27b-3p

Accession MIMAT0036108
Sequence

67 - 

uucacaguggcuaaguucugc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).