Stem-loop sequence chi-mir-27a

AccessionMI0030722 (change log)
DescriptionCapra hircus miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

10 open access papers mention chi-mir-27a
(32 sentences)

Stem-loop
   ugg       -a  a         ug  u       g u cac 
5'    ccugggg  gc gggcuuagc  cu gugagca g c   a
      |||||||  || |||||||||  || ||||||| | |    
3'    gggcccc  cg cuugaaucg  ga cacuugu c g   u
   ---       cc  c         gu  -       g u aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 10075498-10075580 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-27a
chi-mir-23achr7: 10075323-10075397 [+]
chi-mir-27achr7: 10075498-10075580 [+]
Database links

Mature sequence chi-miR-27a-5p

Accession MIMAT0036105
Sequence

14 - 

agggcuuagcugcuugugagca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-27a-3p

Accession MIMAT0036106
Sequence

54 - 

uucacaguggcuaaguuccg

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).