Stem-loop sequence chi-mir-26b

AccessionMI0030721 (change log)
DescriptionCapra hircus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Literature search

4 open access papers mention chi-mir-26b
(4 sentences)

Stem-loop
   -----------------acccugc    ga   -   u        uc           u ug 
5'                         ccgg  ccc agu caaguaau  aggauagguug g  c
                           ||||  ||| ||| ||||||||  ||||||||||| |   
3'                         ggcc  ggg ucg guucauua  ucuuguccgac c  u
   gggagugggguuccgacgucccgu    gg   c   -        cc           - ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr2: 110951723-110951830 [+]
intergenic
Database links

Mature sequence chi-miR-26b-5p

Accession MIMAT0036103
Sequence

19 - 

uucaaguaauucaggauagguu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-26b-3p

Accession MIMAT0036104
Sequence

54 - 

ccuguucuccauuacuuggcuc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).