Stem-loop sequence chi-mir-26a

AccessionMI0030720 (change log)
DescriptionCapra hircus miR-26a stem-loop
Gene family MIPF0000043; mir-26
Literature search

11 open access papers mention chi-mir-26a
(20 sentences)

Stem-loop
   a     -   g  u   u         c          g gca g 
5'  aggcc gug cc cgu caaguaauc aggauaggcu u   g u
    ||||| ||| || ||| ||||||||| |||||||||| |   |  
3'  uccgg cgc gg gca guucauugg ucuuauccgg g   c c
   g     g   a  c   c         c          g -aa c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr22: 11745483-11745572 [+]
intergenic
Database links

Mature sequence chi-miR-26a-5p

Accession MIMAT0036101
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-26a-3p

Accession MIMAT0036102
Sequence

55 - 

ccuauucucgguuacuugcacg

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).