Stem-loop sequence chi-mir-2284e

AccessionMI0030717 (change log)
DescriptionCapra hircus miR-2284e stem-loop
Gene family MIPF0000747; mir-2284
Literature search

3 open access papers mention chi-mir-2284e
(5 sentences)

Stem-loop
   gcu          ag     a  a     ug        -      
5'    auauuggguu  ccaaa ag ucauu  gguuuuuc ugaug 
      ||||||||||  ||||| || |||||  |||||||| |||| a
3'    uaugacucaa  gguuu uc aguaa  ucaaaagg auugu 
   uau          cu     c  a     gu        u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 68587243-68587332 [+]
intergenic
Database links

Mature sequence chi-miR-2284e

Accession MIMAT0036096
Sequence

54 - 

aaaacuugaaugaacucuuugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).