Stem-loop sequence chi-mir-24

AccessionMI0030713 (change log)
DescriptionCapra hircus miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

5 open access papers mention chi-mir-24
(5 sentences)

Stem-loop
   gacc  cc    g  g   a         ua     ucuca 
5'     cg  cucc gu ccu cugagcuga  ucagu     u
       ||  |||| || ||| |||||||||  |||||     u
3'     gc  gagg ca gga gacuugacu  gguca     u
   ---a  -u    a  a   c         -c     cacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 82819368-82819447 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-24
chi-mir-23bchr8: 82818597-82818683 [+]
chi-mir-27bchr8: 82818815-82818918 [+]
chi-mir-24chr8: 82819368-82819447 [+]
Database links

Mature sequence chi-miR-24-5p

Accession MIMAT0036090
Sequence

14 - 

gugccuacugagcugauauc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-24-3p

Accession MIMAT0036091
Sequence

52 - 

uggcucaguucagcaggaac

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).