Stem-loop sequence chi-mir-23a

AccessionMI0030711 (change log)
DescriptionCapra hircus miR-23a stem-loop
Gene family MIPF0000027; mir-23
Literature search

4 open access papers mention chi-mir-23a
(8 sentences)

Stem-loop
   u  c   c     -       g    g      c  c 
5'  gg cgg ugggg uuccugg gaug gauuug ug c
    || ||| ||||| ||||||| |||| |||||| || u
3'  cc gcc accuu agggacc uuac cuaaac ac g
   c  a   a     u       g    a      -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 10075323-10075397 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-23a
chi-mir-23achr7: 10075323-10075397 [+]
chi-mir-27achr7: 10075498-10075580 [+]
Database links

Mature sequence chi-miR-23a

Accession MIMAT0036087
Sequence

46 - 

aucacauugccagggauuucc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).