Stem-loop sequence chi-mir-2318

AccessionMI0030706 (change log)
DescriptionCapra hircus miR-2318 stem-loop
Gene family MIPF0001968; mir-2318
Literature search

1 open access papers mention chi-mir-2318
(1 sentences)

Stem-loop
   ---u    g  -accccg       ugaauuaucuga 
5'     guca ga       uguauga            c
       |||| ||       |||||||            c
3'     cggu cu       auauacu            c
   cucu    g  cuucgua       cuccguuaucgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr15: 79923093-79923165 [+]
intergenic
Database links

Mature sequence chi-miR-2318

Accession MIMAT0036082
Sequence

13 - 

cguguaugaugaauuaucugacc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).