Stem-loop sequence chi-mir-2284d

AccessionMI0030704 (change log)
DescriptionCapra hircus miR-2284d stem-loop
Gene family MIPF0000747; mir-2284
Literature search

3 open access papers mention chi-mir-2284d
(5 sentences)

Stem-loop
   aaaugu   cu       -   caua    g  ac 
5'       uca  gaaguuu uuc    gggu uc  a
         |||  ||||||| |||    |||| ||   
3'       ggu  uuucaaa aag    ucca ag  g
   -----c   -u       c   ----    a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr26: 47341518-47341578 [-]
intergenic
Database links

Mature sequence chi-miR-2284d

Accession MIMAT0036080
Sequence

39 - 

gaaaccugaacaaacuuuuugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).