Stem-loop sequence chi-mir-2284b

AccessionMI0030702 (change log)
DescriptionCapra hircus miR-2284b stem-loop
Gene family MIPF0000747; mir-2284
Literature search

3 open access papers mention chi-mir-2284b
(5 sentences)

Stem-loop
   cua  u        a                aa      cc 
5'    gg guuggcug aaaguuuguucggguu  ucugua  a
      || |||||||| ||||||||||||||||  ||||||   
3'    cc caaucggu uuucaaacaagucuaa  agauau  u
   uga  -        a                aa      uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 125835369-125835451 [+]
intergenic
Database links

Mature sequence chi-miR-2284b

Accession MIMAT0036078
Sequence

13 - 

ugaaaaguuuguucggguua

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).