Stem-loop sequence chi-mir-2284a

AccessionMI0030701 (change log)
DescriptionCapra hircus miR-2284a stem-loop
Gene family MIPF0000747; mir-2284
Literature search

3 open access papers mention chi-mir-2284a
(5 sentences)

Stem-loop
   -  uua   u       -c   g          u  ca 
5'  gg   gcc aaaaguu  guu ggguuuuucu ua  a
    ||   ||| |||||||  ||| |||||||||| ||   
3'  cc   cgg uuuuuaa  caa cccaaaaagg au  u
   a  ---   -       aa   a          u  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence chi-miR-2284a

Accession MIMAT0036077
Sequence

9 - 

uaaaaguucguugggguuuuu

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).