Stem-loop sequence chi-mir-224

AccessionMI0030699 (change log)
DescriptionCapra hircus miR-224 stem-loop
Gene family MIPF0000088; mir-224
Literature search

1 open access papers mention chi-mir-224
(1 sentences)

Stem-loop
          ca         u   u      a --ua    gu 
5' gggcuuu  agucacuag ggu ccguuu g    gaug  u
   |||||||  ||||||||| ||| |||||| |    ||||   
3' cccgaaa  ucagugauc cca gguaaa c    uuac  g
          ca         -   u      a uuug    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 56575904-56575984 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-224
chi-mir-224chrX: 56575904-56575984 [-]
chi-mir-3431chrX: 56573960-56574056 [-]
Database links

Mature sequence chi-miR-224-5p

Accession MIMAT0036073
Sequence

8 - 

caagucacuagugguuccguuu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-224-3p

Accession MIMAT0036074
Sequence

54 - 

aaaugguacccuagugacuaca

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).