Stem-loop sequence chi-mir-223

AccessionMI0030698 (change log)
DescriptionCapra hircus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

3 open access papers mention chi-mir-223
(15 sentences)

Stem-loop
   cca  cuucu   -     au   cu u              gaguug      c a 
5'    gc     gca gugcc  gcu  g guauuugacaagcu      gacacu c u
      ||     ||| |||||  |||  | ||||||||||||||      |||||| | g
3'    cg     cgu uacgg  uga  c cauaaacuguuuga      cuguga g u
   -ga  --auc   a     cg   ac c              ------      u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 88490300-88490406 [+]
intergenic
Database links

Mature sequence chi-miR-223-5p

Accession MIMAT0036071
Sequence

25 - 

uguguauuugacaagcugaguug

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-223-3p

Accession MIMAT0036072
Sequence

65 - 

ugucaguuugucaaauacccca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).