Stem-loop sequence chi-mir-222

AccessionMI0030697 (change log)
DescriptionCapra hircus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Literature search

5 open access papers mention chi-mir-222
(16 sentences)

Stem-loop
   cagcugcu  aau ugu    a  c   au              -     auc   ucuu 
5'         gg   g   aggu cc uca  ggcucaguagccag uguag   cug    u
           ||   |   |||| || |||  |||||||||||||| |||||   |||    u
3'         cc   c   ucua gg agu  cugggucaucgguc acauc   gac    g
   -------u  -au --u    c  u   cu              u     gau   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chrX: 93117133-93117244 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-222
chi-mir-222chrX: 93117133-93117244 [+]
chi-mir-221chrX: 93117822-93117931 [+]
Database links

Mature sequence chi-miR-222-3p

Accession MIMAT0036070
Sequence

71 - 

agcuacaucuggcuacugggucuc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).