Stem-loop sequence chi-mir-218

AccessionMI0030694 (change log)
DescriptionCapra hircus miR-218 stem-loop
Gene family MIPF0000026; mir-218
Literature search

1 open access papers mention chi-mir-218
(1 sentences)

Stem-loop
   gac   uc -c     g       uuu         cu        gguggaacga  g 
5'    cag  g  cgcgg gcuuucc   gugcuugau  aaccaugu          ug a
      |||  |  ||||| |||||||   |||||||||  ||||||||          ||  
3'    guc  c  gcgcc cgaaagg   cacgaacug  uugguaca          gc a
   -ac   cu uc     a       cgc         uc        --------ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr20: 583380-583489 [-]
intergenic
Database links

Mature sequence chi-miR-218

Accession MIMAT0036066
Sequence

25 - 

uugugcuugaucuaaccaugu

 - 45

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).