Stem-loop sequence chi-mir-21

AccessionMI0030691 (change log)
DescriptionCapra hircus miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

17 open access papers mention chi-mir-21
(71 sentences)

Stem-loop
   u      ccu      gu        a     a     a    u a 
5'  guacca   ugucgg  agcuuauc gacug uguug cugu g a
    ||||||   ||||||  |||||||| ||||| ||||| |||| | u
3'  uauggu   acaguc  ucggguag cugac acaac ggua c c
   c      uuu      ug        -     g     -    - u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 10841436-10841527 [+]
intergenic
Database links

Mature sequence chi-miR-21-5p

Accession MIMAT0036061
Sequence

18 - 

uagcuuaucagacugauguugac

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-21-3p

Accession MIMAT0036062
Sequence

56 - 

caacagcagucgaugggcugu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).