Stem-loop sequence chi-mir-215

AccessionMI0030690 (change log)
DescriptionCapra hircus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

2 open access papers mention chi-mir-215
(2 sentences)

Stem-loop
   ------auu    aau           a a  a     -   u         augg     
5'          caga   gguguacagga a ug ccuau gaa ugacagaca    gacu 
            ||||   ||||||||||| | || ||||| ||| |||||||||    ||| a
3'          gucu   cuauaugucuu u ac ggaug cuu acugucugu    cuga 
   aacuucagc    ---           a a  c     u   u         ----     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 23073850-23073956 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-215
chi-mir-194chr16: 23074153-23074249 [-]
chi-mir-215chr16: 23073850-23073956 [-]
Database links

Mature sequence chi-miR-215-5p

Accession MIMAT0036060
Sequence

24 - 

augaccuaugaauugacagac

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).