Stem-loop sequence chi-mir-211

AccessionMI0030688 (change log)
DescriptionCapra hircus miR-211 stem-loop
Gene family MIPF0000042; mir-204
Literature search

3 open access papers mention chi-mir-211
(21 sentences)

Stem-loop
   -   --c   -gccgu     cug     u         ca     u    agggu 
5'  ucc   cug      gugac   ugggc ucccuuugu  uccuu gccc     u
    |||   |||      |||||   ||||| |||||||||  ||||| ||||     c
3'  agg   gac      cacug   acucg ggggaaacg  aggga cggg     u
   g   cac   acccuc     cug     u         ac     -    gugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 27873858-27873967 [-]
intergenic
Database links

Mature sequence chi-miR-211

Accession MIMAT0036057
Sequence

26 - 

uucccuuugucauccuuugccc

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).