Stem-loop sequence chi-mir-20a

AccessionMI0030686 (change log)
DescriptionCapra hircus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention chi-mir-20a
(2 sentences)

Stem-loop
   g  u  c  --g      ucu    c   -a                 g   -  uu 
5'  ug ga gu   acagcu   guag acu  aagugcuuauagugcag uag ug  u
    || || ||   ||||||   |||| |||  ||||||||||||||||| ||| ||   
3'  ac cu ca   ugucga   cguc uga  uucacgaguauuacguc auc au  a
   g  -  -  aga      --u    a   aa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66729906-66730012 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-20a
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-20a-5p

Accession MIMAT0036054
Sequence

27 - 

uaaagugcuuauagugcagguag

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-20a-3p

Accession MIMAT0036055
Sequence

63 - 

acugcauuaugagcacuuaaa

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).