Stem-loop sequence chi-mir-206

AccessionMI0030684 (change log)
DescriptionCapra hircus miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

6 open access papers mention chi-mir-206
(22 sentences)

Stem-loop
   u    c  a                     cc     -    u 
5'  gcuu cc aggccacaugcuucuuuauau  ccaua cgga u
    |||| || |||||||||||||||||||||  ||||| ||||  
3'  cgag gg uuuggugugugaaggaaugua  gguau guuu a
   g    c  c                     -a     c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr23: 25415849-25415934 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-206
chi-mir-206chr23: 25415849-25415934 [+]
chi-mir-133bchr23: 25419918-25420022 [+]
Database links

Mature sequence chi-miR-206

Accession MIMAT0036052
Sequence

53 - 

uggaauguaaggaaguguguggu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).