Stem-loop sequence chi-mir-204

AccessionMI0030683 (change log)
DescriptionCapra hircus miR-204 stem-loop
Gene family MIPF0000042; mir-204
Literature search

3 open access papers mention chi-mir-204
(23 sentences)

Stem-loop
   ggcuacagucuuucuucau     ucg     u          a     u    gagaau 
5'                    gugac   uggac ucccuuuguc uccua gccu      a
                      |||||   ||||| |||||||||| ||||| ||||      u
3'                    uacug   acuug agggaaacgg agggu cgga      a
   ----------------cac     uua     c          a     -    ggaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr8: 47426384-47426489 [-]
intergenic
Database links

Mature sequence chi-miR-204-5p

Accession MIMAT0036050
Sequence

33 - 

uucccuuugucauccuaugccu

 - 54

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-204-3p

Accession MIMAT0036051
Sequence

72 - 

gcugggaaggcaaagggac

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).