Stem-loop sequence chi-mir-202

AccessionMI0030682 (change log)
DescriptionCapra hircus miR-202 stem-loop
Gene family MIPF0000121; mir-202
Literature search

2 open access papers mention chi-mir-202
(2 sentences)

Stem-loop
   ------gcca    cu     u           -a           g   gu 
5'           cucg  guucc uuuuccuaugc  uauacuucuuu agg  c
             ||||  ||||| |||||||||||  ||||||||||| |||   
3'           gagc  cgggg aaaaggguacg  auguggagaaa ucc  u
   cguccccuug    cc     u           gg           -   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr26: 52891745-52891842 [-]
intergenic
Database links

Mature sequence chi-miR-202-5p

Accession MIMAT0036048
Sequence

19 - 

uuccuaugcauauacuucuuu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-202-3p

Accession MIMAT0036049
Sequence

55 - 

agagguguagggcaugggaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).