Stem-loop sequence chi-mir-200c

AccessionMI0030681 (change log)
DescriptionCapra hircus miR-200c stem-loop
Gene family MIPF0000019; mir-8
Literature search

9 open access papers mention chi-mir-200c
(10 sentences)

Stem-loop
   g  ug      cu    -      a        u   u   gg 
5'  gg  ggggcc  cguc uuaccc gcaguguu ggg gcu  u
    ||  ||||||  |||| |||||| |||||||| ||| |||  u
3'  cu  ccccgg  guag aauggg cgucauaa cuc uga  g
   -  gu      ag    u      c        u   -   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr5: 104155533-104155618 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-200c
chi-mir-200cchr5: 104155533-104155618 [-]
chi-mir-141chr5: 104155114-104155203 [-]
Database links

Mature sequence chi-miR-200c

Accession MIMAT0036047
Sequence

54 - 

uaauacugccggguaaugaugga

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).