Stem-loop sequence chi-mir-200b

AccessionMI0030680 (change log)
DescriptionCapra hircus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

9 open access papers mention chi-mir-200b
(16 sentences)

Stem-loop
   -------g   u  c    -    ug     c      u  ug 
5'         cca cg cauc uuac  ggcag auugga gg  u
           ||| || |||| ||||  ||||| |||||| ||  c
3'         ggu gc guag aaug  ccguc uaaucu cu  u
   cgucccgg   c  a    u    gu     a      -  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 51960891-51960970 [-]
intergenic
Database links

Mature sequence chi-miR-200b

Accession MIMAT0036046
Sequence

45 - 

uaauacugccugguaaugauga

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).