Stem-loop sequence chi-mir-200a

AccessionMI0030679 (change log)
DescriptionCapra hircus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

12 open access papers mention chi-mir-200a
(20 sentences)

Stem-loop
   --   - c   g        -             c    u  cuc 
5'   ggg c ucu uggacauc uuaccggacagug ugga uu   a
     ||| | ||| |||||||| ||||||||||||| |||| ||    
3'   ccc g gga acuuguag aauggucugucac aucu aa   g
   ca   a u   a        c             a    c  cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
AJPT02077529.1: 1264-1351 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-200a
chi-mir-200aAJPT02077529.1: 1264-1351 [-]
chi-mir-429AJPT02077529.1: 34-117 [-]
Database links

Mature sequence chi-miR-200a

Accession MIMAT0036045
Sequence

52 - 

uaacacugucugguaacgaug

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).