Stem-loop sequence chi-mir-19a

AccessionMI0030677 (change log)
DescriptionCapra hircus miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

1 open access papers mention chi-mir-19a
(1 sentences)

Stem-loop
       u  u                 --      ---    ag 
5' gcag cc cuguuaguuuugcauag  uugcac   uaca  a
   |||| || |||||||||||||||||  ||||||   ||||  a
3' cguc gg gguagucaaaacguauc  aacgug   augu  g
       c  u                 ua      uug    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66729756-66729837 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-19a
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-19a

Accession MIMAT0036042
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).