Stem-loop sequence chi-mir-199b

AccessionMI0030675 (change log)
DescriptionCapra hircus miR-199b stem-loop
Gene family MIPF0000040; mir-199
Literature search

5 open access papers mention chi-mir-199b
(7 sentences)

Stem-loop
   -------cc    cu  -     c       u       u    u  ----  a 
5'          ucca  cc gucua ccagugu uagacua cugu ca    gg c
            ||||  || ||||| ||||||| ||||||| |||| ||    ||  
3'          gggu  gg cggau gguuaca gucugau gaca gu    cc u
   ucccagagu    cg  u     u       c       -    u  uaaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence chi-miR-199b-5p

Accession MIMAT0036038
Sequence

16 - 

cccaguguuuagacuaucuguuc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-199b-3p

Accession MIMAT0036039
Sequence

55 - 

acaguagucugcacauugguu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).