Stem-loop sequence chi-mir-199a

AccessionMI0030674 (change log)
DescriptionCapra hircus miR-199a stem-loop
Gene family MIPF0000040; mir-199
Literature search

4 open access papers mention chi-mir-199a
(5 sentences)

Stem-loop
   uggaa   u  ggaga    -    c   gcc       u        c   --uca  ac 
5'      gcu cu     uccu gcuc guc   ccagugu cagacuac ugu     gg  a
        ||| ||     |||| |||| |||   ||||||| |||||||| |||     ||   
3'      cga ga     ggga cggg cag   gguuaca gucugaug aca     cc  a
   ----a   -  -----    a    u   auu       c        -   uguug  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 39507404-39507513 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-199a
chi-mir-199achr16: 39507404-39507513 [-]
chi-mir-214chr16: 39501613-39501724 [-]
Database links

Mature sequence chi-miR-199a-5p

Accession MIMAT0036036
Sequence

31 - 

cccaguguucagacuaccuguuc

 - 53

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-199a-3p

Accession MIMAT0036037
Sequence

70 - 

acaguagucugcacauugguu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).