Stem-loop sequence chi-mir-196b

AccessionMI0030672 (change log)
DescriptionCapra hircus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Literature search

3 open access papers mention chi-mir-196b
(3 sentences)

Stem-loop
   -      uc      uu       u  c           ucca 
5'  aacugg  ggugau  agguagu uc uguuguuggga    c
    ||||||  ||||||  ||||||| || |||||||||||     
3'  uugacu  ucauua  uccguca ag acgacagcucu    c
   g      --      cu       c  c           cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 70532571-70532655 [+]
intergenic
Database links

Mature sequence chi-miR-196b

Accession MIMAT0036033
Sequence

16 - 

uagguaguuuccuguuguugg

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).