Stem-loop sequence chi-mir-196a

AccessionMI0030671 (change log)
DescriptionCapra hircus miR-196a stem-loop
Gene family MIPF0000031; mir-196
Literature search

6 open access papers mention chi-mir-196a
(11 sentences)

Stem-loop
   u  a ugg       ga    a ua   a    c         - gc u  a 
5'  ga c   aacugcu  guga u  ggu guuu auguuguug g  c gg u
    || |   |||||||  |||| |  ||| |||| ||||||||| |  | ||  
3'  cu g   uugacgg  cacu a  cca caaa uacagcaac c  g uc u
   c  c uca       --    c gc   c    u         a aa -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 38976510-38976611 [+]
intergenic
Database links

Mature sequence chi-miR-196a

Accession MIMAT0036032
Sequence

24 - 

uagguaguuucauguuguugg

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).