Stem-loop sequence chi-mir-195

AccessionMI0030670 (change log)
DescriptionCapra hircus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention chi-mir-195
(1 sentences)

Stem-loop
   ccca  uc     g  cu          -a          cu  gaa 
5'     gc  cccug cu  agcagcacag  aauguuggua  gg   g
       ||  ||||| ||  ||||||||||  ||||||||||  ||    
3'     ug  gggac ga  ucgucguguc  uuauaaccgu  cc   a
   --ag  gu     g  cc          gg          --  gag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr19: 27447708-27447798 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-195
chi-mir-497chr19: 27448017-27448129 [-]
chi-mir-195chr19: 27447708-27447798 [-]
Database links

Mature sequence chi-miR-195-5p

Accession MIMAT0036030
Sequence

18 - 

uagcagcacagaaauguugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-195-3p

Accession MIMAT0036031
Sequence

56 - 

ccaauauuggcugugcugcuc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).