Stem-loop sequence chi-mir-194

AccessionMI0030668 (change log)
DescriptionCapra hircus miR-194 stem-loop
Gene family MIPF0000055; mir-194
Literature search

1 open access papers mention chi-mir-194
(1 sentences)

Stem-loop
   uucuuaa     -       uu         a      g    cu  gc 
5'        uggca ucaucga  guaacagca cuccau ugga  gu  g
          ||||| |||||||  ||||||||| |||||| ||||  ||   
3'        accgu gguaguu  cauugucgu gaggug accu  ua  u
   ucacuca     c       uu         a      -    -u  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr16: 23074153-23074249 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-194
chi-mir-194chr16: 23074153-23074249 [-]
chi-mir-215chr16: 23073850-23073956 [-]
Database links

Mature sequence chi-miR-194

Accession MIMAT0036029
Sequence

21 - 

uguaacagcaacuccaugugga

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).