Stem-loop sequence chi-mir-192

AccessionMI0030665 (change log)
DescriptionCapra hircus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

1 open access papers mention chi-mir-192
(1 sentences)

Stem-loop
   -------------c   u  --   g g  c         -     a       ----u  uc 
5'               gag gc  aca g cu ugaccuaug aauug cagccag     gc  u
                 ||| ||  ||| | || ||||||||| ||||| |||||||     ||   
3'               cuc cg  ugu u ga acuggauac uuaac gucgguc     ug  c
   accaccgaccguaa   -  cu   a g  c         c     c       ucccc  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr29: 44792471-44792577 [-]
intergenic
chr29: 44796495-44796601 [-]
intergenic
Database links

Mature sequence chi-miR-192-5p

Accession MIMAT0036024
Sequence

16 - 

cugaccuaugaauugacagcc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-192-3p

Accession MIMAT0036025
Sequence

59 - 

cugccaauuccauaggucacagg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).