Stem-loop sequence chi-mir-18a

AccessionMI0030660 (change log)
DescriptionCapra hircus miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention chi-mir-18a
(1 sentences)

Stem-loop
   ----         u   --   u   uc   u    a   -  aa u 
5'     gcuuuuugu cua  agg gca  uag gcag uag ug  g a
       ||||||||| |||  ||| |||  ||| |||| ||| ||  | g
3'     ugaagaaua ggu  ucc cgu  auc cguc auc ac  u a
   guau         c   cu   u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66729611-66729699 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-18a
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-18a-5p

Accession MIMAT0036015
Sequence

12 - 

uaaggugcaucuagugcagauag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-18a-3p

Accession MIMAT0036016
Sequence

53 - 

acugcccuaagugcuccuucugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).