Stem-loop sequence chi-mir-184

AccessionMI0030656 (change log)
DescriptionCapra hircus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

3 open access papers mention chi-mir-184
(3 sentences)

Stem-loop
   c       auc         c      ag     uuu  ga 
5'  cagucac   cccuuauca uuuucc  ccagc   gu  c
    |||||||   ||||||||| ||||||  |||||   ||  u
3'  guuagug   gggaauagu aagagg  gguug   ca  c
   a       gau         c      ca     --u  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 25707845-25707927 [+]
intergenic
Database links

Mature sequence chi-miR-184

Accession MIMAT0036009
Sequence

52 - 

uggacggagaacugauaagggu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).