Stem-loop sequence chi-mir-183

AccessionMI0030654 (change log)
DescriptionCapra hircus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

4 open access papers mention chi-mir-183
(9 sentences)

Stem-loop
   ccagaga   u  ---c  -         g      --ac     ga        --   ac 
5'        gcg ga    uc cuguucugu uauggc    uggua  auucacug  uga  a
          ||| ||    || ||||||||| ||||||    |||||  ||||||||  |||   
3'        cgc cu    ag gacgagaca auaccg    gccau  uaagugac  gcu  g
   -----ag   -  agac  a         a      ggaa     --        ug   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 96232544-96232653 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-183
chi-mir-183chr4: 96232544-96232653 [-]
chi-mir-96chr4: 96232297-96232399 [-]
chi-mir-182chr4: 96226171-96226274 [-]
Database links

Mature sequence chi-miR-183

Accession MIMAT0036007
Sequence

27 - 

uauggcacugguagaauucacu

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).