Stem-loop sequence chi-mir-182

AccessionMI0030653 (change log)
DescriptionCapra hircus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Literature search

4 open access papers mention chi-mir-182
(168 sentences)

Stem-loop
   gccgccgccu   uc -      uu       u -g      uca      ugaggu 
5'           gcc  c caccau  uuggcaa g  uagaac   cacugg      a
             |||  | ||||||  ||||||| |  ||||||   ||||||       
3'           cgg  g guggua  aaccguu c  aucuug   guggcc      a
   ------gacu   ga u      uc       - ag      ---      uagggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr4: 96226171-96226274 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-182
chi-mir-183chr4: 96232544-96232653 [-]
chi-mir-96chr4: 96232297-96232399 [-]
chi-mir-182chr4: 96226171-96226274 [-]
Database links

Mature sequence chi-miR-182

Accession MIMAT0036006
Sequence

24 - 

uuuggcaaugguagaacucac

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).