Stem-loop sequence chi-mir-181d

AccessionMI0030652 (change log)
DescriptionCapra hircus miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention chi-mir-181d
(8 sentences)

Stem-loop
   u   -c      -    ----caca  aaa       auca         g ug          gugac g 
5'  ccc  ucccuu aggc        gc   ggucaca    acauucauu u  ucgguggguu     g a
    |||  |||||| ||||        ||   |||||||    ||||||||| |  ||||||||||     |  
3'  ggg  aggggg uccg        cg   ucggugu    uguaaguag g  agccacccag     c g
   -   ua      c    acacagac  -gg       -cac         g --          ---ac a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 10034037-10034166 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-181d
chi-mir-181cchr7: 10034232-10034324 [-]
chi-mir-181dchr7: 10034037-10034166 [-]
Database links

Mature sequence chi-miR-181d

Accession MIMAT0036005
Sequence

35 - 

aacauucauuguugucggugggu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).