Stem-loop sequence chi-mir-181c

AccessionMI0030651 (change log)
DescriptionCapra hircus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention chi-mir-181c
(6 sentences)

Stem-loop
   ------caa      g    aa        cu       a     ggca 
5'          ggguuu gggg  cauucaac  gucggug guuug    g
            |||||| ||||  ||||||||  ||||||| |||||    c
3'          uccgga cccc  gugaguug  cagcuac caaac    u
   ccgucaagg      g    ag        -c       -     ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr7: 10034232-10034324 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-181c
chi-mir-181cchr7: 10034232-10034324 [-]
chi-mir-181dchr7: 10034037-10034166 [-]
Database links

Mature sequence chi-miR-181c-5p

Accession MIMAT0036003
Sequence

15 - 

aacauucaaccugucggugag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-181c-3p

Accession MIMAT0036004
Sequence

54 - 

accaucgaccguugaguggacc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).