Stem-loop sequence chi-mir-181b

AccessionMI0030650 (change log)
DescriptionCapra hircus miR-181b stem-loop
Gene family MIPF0000007; mir-181
Literature search

6 open access papers mention chi-mir-181b
(10 sentences)

Stem-loop
   cuga   -     cucaa         cu           u  cu 
5'     ugg cugca     cauucauug  gucgguggguu ga  u
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguaac  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr11: 98560989-98561077 [+]
intergenic
Database links

Mature sequence chi-miR-181b-5p

Accession MIMAT0036001
Sequence

16 - 

aacauucauugcugucggugggu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-181b-3p

Accession MIMAT0036002
Sequence

54 - 

cucacugaucaaugaaugcaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).