Stem-loop sequence chi-mir-17

AccessionMI0030648 (change log)
DescriptionCapra hircus miR-17 stem-loop
Gene family MIPF0000001; mir-17
Literature search

6 open access papers mention chi-mir-17
(6 sentences)

Stem-loop
       ga       -ca        a  g     g   -  au 
5' guca  auaaugu   aagugcuu ca ugcag uag ug  u
   ||||  |||||||   |||||||| || ||||| ||| ||  u
3' cagu  uauuacg   uucacgga gu acguc auc ac  g
       gg       aug        a  g     -   u  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 66729474-66729557 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-17
chi-mir-17chr12: 66729474-66729557 [+]
chi-mir-18achr12: 66729611-66729699 [+]
chi-mir-19achr12: 66729756-66729837 [+]
chi-mir-20achr12: 66729906-66730012 [+]
chi-mir-19bchr12: 66730053-66730139 [+]
chi-mir-92achr12: 66730161-66730259 [+]
Database links

Mature sequence chi-miR-17-5p

Accession MIMAT0035998
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-17-3p

Accession MIMAT0035999
Sequence

51 - 

acugcagugaaggcacuuguagca

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).