Stem-loop sequence chi-mir-16a

AccessionMI0030646 (change log)
DescriptionCapra hircus miR-16a stem-loop
Gene family MIPF0000006; mir-15
Literature search

6 open access papers mention chi-mir-16a
(13 sentences)

Stem-loop
         ag   c          -  a          u   gauu 
5' gucagc  ugc uuagcagcac gu aauauuggag uaa    c
   ||||||  ||| |||||||||| || |||||||||| |||     
3' caguug  aug agucgucgug ca uuaugaccuc auu    u
         ga   a          u  a          u   aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 18725843-18725931 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-16a
chi-mir-15achr12: 18725978-18726072 [-]
chi-mir-16achr12: 18725843-18725931 [-]
Database links

Mature sequence chi-miR-16a-5p

Accession MIMAT0035994
Sequence

14 - 

uagcagcacguaaauauuggag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-16a-3p

Accession MIMAT0035995
Sequence

47 - 

aaauuaucuccaguauuaacugugcugc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).