Stem-loop sequence chi-mir-15b

AccessionMI0030645 (change log)
DescriptionCapra hircus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

6 open access papers mention chi-mir-15b
(8 sentences)

Stem-loop
   u    --g       gua   u       c  c      ua   a  ac 
5'  ugag   ccuuaaa   cug agcagca au augguu  cau cu  a
    ||||   |||||||   ||| ||||||| || ||||||  ||| ||  g
3'  acuu   ggaauuu   gau ucgucgu ua uacuaa  gua ga  u
   u    aaa       aaa   c       u  u      gc   -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr1: 109436450-109436547 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-15b
chi-mir-15bchr1: 109436450-109436547 [-]
chi-mir-16bchr1: 109436307-109436403 [-]
Database links

Mature sequence chi-miR-15b-5p

Accession MIMAT0035992
Sequence

20 - 

uagcagcacaucaugguuuaca

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-15b-3p

Accession MIMAT0035993
Sequence

58 - 

cgaaucauuauuugcugcucu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).