Stem-loop sequence chi-mir-15a

AccessionMI0030644 (change log)
DescriptionCapra hircus miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

5 open access papers mention chi-mir-15a
(56 sentences)

Stem-loop
   ----------a     gaguaaa ua        ua          ga  u 
5'            ccuug       g  gcagcaca  augguuugug  uu u
              |||||       |  ||||||||  ||||||||||  || g
3'            ggaac       c  cgucgugu  uaccggacgu  aa a
   cuucuagucua     auaaaaa uc        ua          gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr12: 18725978-18726072 [-]
intergenic
Clustered miRNAs
< 10kb from chi-mir-15a
chi-mir-15achr12: 18725978-18726072 [-]
chi-mir-16achr12: 18725843-18725931 [-]
Database links

Mature sequence chi-miR-15a-5p

Accession MIMAT0035990
Sequence

15 - 

uagcagcacauaaugguuugugg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-15a-3p

Accession MIMAT0035991
Sequence

52 - 

caggccauauugugcugccuca

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).