Stem-loop sequence chi-mir-154b

AccessionMI0030642 (change log)
DescriptionCapra hircus miR-154b stem-loop
Gene family MIPF0000018; mir-154
Literature search

6 open access papers mention chi-mir-154b
(10 sentences)

Stem-loop
   --a   auacuugg                   uu     -   c     - uuua 
5'    gag        ugguacuugaagagagguc  ccaug gug auucg c    u
      |||        |||||||||||||||||||  ||||| ||| ||||| |     
3'    uuc        acuauggauuuuuuuccag  gguac uac uaagc g    u
   aag   cggucuaa                   uu     a   -     a uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67137892-67138000 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-154b
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-154b-5p

Accession MIMAT0035986
Sequence

25 - 

agaggucuuccauggugcauuc

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-154b-3p

Accession MIMAT0035987
Sequence

64 - 

aucauacaugguugaccuuuuuu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).