Stem-loop sequence chi-mir-154a

AccessionMI0030641 (change log)
DescriptionCapra hircus miR-154a stem-loop
Gene family MIPF0000018; mir-154
Literature search

5 open access papers mention chi-mir-154a
(9 sentences)

Stem-loop
   ugcuaaucu      ------c       -     uau       gcc    - uuu 
5'          gcggga       uugaaga uaggu   ccgugua   uucg c   a
            ||||||       ||||||| |||||   |||||||   |||| |   c
3'          cgcccu       gacuuuu aucca   ggcacau   aagc g   u
   ----gguuc      aaaccau       c     cuu       acu    a ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CHIR_2.0; GCA_000317765.2) Overlapping transcripts
chr21: 67137564-67137668 [+]
intergenic
Clustered miRNAs
< 10kb from chi-mir-154a
chi-mir-487achr21: 67127794-67127896 [+]
chi-mir-382chr21: 67130720-67130845 [+]
chi-mir-134chr21: 67131102-67131209 [+]
chi-mir-485chr21: 67131798-67131912 [+]
chi-mir-382chr21: 67132394-67132519 [+]
chi-mir-134chr21: 67132776-67132883 [+]
chi-mir-485chr21: 67133472-67133586 [+]
chi-mir-154achr21: 67137564-67137668 [+]
chi-mir-154bchr21: 67137892-67138000 [+]
chi-mir-496chr21: 67138399-67138519 [+]
chi-mir-377chr21: 67139994-67140124 [+]
chi-mir-409chr21: 67142870-67142983 [+]
chi-mir-412chr21: 67142997-67143118 [+]
chi-mir-369chr21: 67143159-67143265 [+]
chi-mir-410chr21: 67143473-67143597 [+]
chi-mir-323bchr21: 67144000-67144109 [+]
Database links

Mature sequence chi-miR-154a-5p

Accession MIMAT0035984
Sequence

24 - 

uagguuauccguguagccu

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence chi-miR-154a-3p

Accession MIMAT0035985
Sequence

60 - 

aaucauacacgguucaccuacu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).